Consolidated Catalogue

Strain No.UNIQEM 40062
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40062 < Bryantseva I.A. UNIQEM 258
LocationMono Lake
GeographicsMono Lake
CountryUSA
Medium261
Incubation temp. (C)25
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40063
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40063 < Bryantseva I.A., UNIQEM 260
LocationMono Lake
GeographicsMono Lake
CountryUSA
Medium261
Incubation temp. (C)25
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40064
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40064 < Bryantseva I.A., UNIQEM 257
LocationMono Lake
GeographicsMono Lake
CountryUSA
Medium261
Incubation temp. (C)25
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40065
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40065 < Bryantseva I.A., UNIQEM 259
LocationMono Lake
GeographicsMono Lake
CountryUSA
Medium261
Incubation temp. (C)25
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40066
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40066 < Bryantseva I.A. UNIQEM 261
LocationMono Lake
GeographicsMono Lake
CountryUSA
Medium261
Incubation temp. (C)25
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40310
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40310 <-- D.Yu. Sorokin, Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain ASL6, 1999
Source of isolationsulfide-rich haloalkaline water
GeographicsWashington State, Grant County, Soap Lake
CountryUSA
Medium443
Incubation temp. (C)28
Storage methodsC-1
DNA sequences16S rRNA gene: DQ900621.1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40327
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40327 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 380 = ES1
Source of isolationsoda solonchak soil
GeographicsWadi Natrun
CountryEgypt
Incubation temp. (C)25
Storage methodsC-1
DNA sequences16S rRNA gene: EU143686
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40328
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40328 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 379= MS5
Source of isolationsoda solonchak soil
GeographicsMongolian north-eastern area
CountryMongolia
Incubation temp. (C)25
Storage methodsC-1
DNA sequences16S rRNA gene: EU143684
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40332
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40332 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 933 = 93dLM4-
Source of isolationsoda lake
GeographicsLake Magadi, Kenyan Rift Valley
CountryKenya
Incubation temp. (C)37
Storage methodsC-1
DNA sequences16S rRNA gene: X92170
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40339
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40339 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 1004 = AMET-SL
Source of isolationhighly alkaline saline soda lake
GeographicsSearles Lake, California
CountryUSA
Incubation temp. (C)50
Storage methodsC-1
DNA sequences16S rRNA gene: KY449327
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40410
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40410 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 922 = ACht9
Source of isolationsoda solonchak soil near Tanatar-6 soda lake
GeographicsKulunda Steppe
CountryKulunda Steppe
Incubation temp. (C)30
Storage methodsC-1
DNA sequences16S rRNA gene: JQ901943
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40442
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40442 <-- D.Yu. Sorokin, Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 289 = AL 22
Source of isolationsoda lake
Geographicsunknown origin
Medium336
Incubation temp. (C)30
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40443
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40443 <-- D.Yu. Sorokin, Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 290 = 5B-1
Source of isolationsoda lake
GeographicsBitter-1 Lake, Kulunda steppe
CountryRussia
Medium336
Incubation temp. (C)30
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40448
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40448 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 986 = AMET4
Source of isolationsediments from hypersaline soda lakes
GeographicsKulunda Steppe, Altai
CountryRussian Federation
Incubation temp. (C)48
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40449
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40449 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 987 = AMET5
Source of isolationsediments from hypersaline soda lakes
GeographicsKulunda Steppe, Altai
CountryRussian Federation
Incubation temp. (C)48
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40450
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40450 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 988 = AMET6-2
Source of isolationsediments from hypersaline soda lakes
GeographicsWadi Natrun
CountryEgypt
Incubation temp. (C)60
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40453
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40453 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 985 = AMET3
Source of isolationsediments from hypersaline soda lakes
GeographicsKulunda Steppe, Altai
CountryRussian Federation
Incubation temp. (C)48
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40455
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40455 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 984 = AMET2
Source of isolationsediments from hypersaline soda lakes
GeographicsWadi Natrun
CountryEgypt
Incubation temp. (C)60
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40463
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40463 <-- D.Yu. Sorokin, UNIQEM 973; Aarcel, 2013
Source of isolationmixed sample hypersaline lake
GeographicsLibyan desert, Wadi el Natrun valley
CountryEgypt
Incubation temp. (C)37
Storage methodsC-1
DNA sequences16S rRNA gene: KT247982.1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40472
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40472 <-- D.Yu. Sorokin, UNIQEM 989; AMET7, 2012
Source of isolationsoda crystallizer
GeographicsKulunda Steppe
CountryRussian Federation
Incubation temp. (C)55
Storage methodsC-1
DNA sequences16S rRNA gene: KY449323.1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40478
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40478 <-- D.Yu. Sorokin, Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 357 = AL 31
Source of isolationsoda lake
Geographicsunknown origin
Medium336
Incubation temp. (C)30
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40479
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40479 <-- D.Yu. Sorokin, Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 356 = AL 30
Source of isolationsoda lake
Geographicsunknown origin
Medium336
Incubation temp. (C)30
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40480
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40480 <-- D.Yu. Sorokin, Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 355 = AL 29
Source of isolationsoda lake
Geographicsunknown origin
Medium336
Incubation temp. (C)30
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40481
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40481 <-- D.Yu. Sorokin, Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 354 = AL 28
Source of isolationsoda lake
Geographicsunknown origin
Medium336
Incubation temp. (C)30
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40483
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40483 <-- D.Yu. Sorokin, Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 352 = AL 26
Source of isolationsoda lake
Geographicsunknown origin
Medium336
Incubation temp. (C)30
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40484
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40484 <-- D.Yu. Sorokin, Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 351 = AL 25
Source of isolationsoda lake
Geographicsunknown origin
Medium336
Incubation temp. (C)30
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40485
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40485 <-- D.Yu. Sorokin, Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 350 = AL 24
Source of isolationsoda lake
Geographicsunknown origin
Medium336
Incubation temp. (C)30
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40486
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40486 <-- D.Yu. Sorokin, Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 349 = AL 23
Source of isolationsoda lake
Geographicsunknown origin
Medium336
Incubation temp. (C)30
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40495
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40495 <-- D.Yu. Sorokin, Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 340= ALMg10
Source of isolationsoda lake
GeographicsNortheastern
CountryMongolia
Incubation temp. (C)30
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40514
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40514 <-- D.Yu. Sorokin, UNIQEM 793; AHT16, 2009
Source of isolationsurface sediments of soda lake
GeographicsKulunda Steppe
CountryRussian Federation
Medium235
Incubation temp. (C)30
Storage methodsC-1
DNA sequences16S rRNA gene: FJ788524
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40518
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40518 <-- D.Yu. Sorokin, UNIQEM 803; APP1, 2009
Source of isolationD.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia
GeographicsKulunda Steppe
CountryRussia
Incubation temp. (C)30
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40519
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40519 <-- D.Yu. Sorokin, UNIQEM 804; AP61, 2009
Source of isolationD.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia
GeographicsKulunda Steppe
CountryRussia
Incubation temp. (C)30
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40533
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40533 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 894 = Acht7, 2010
Source of isolationsediments of soda lake
GeographicsAltai, south-eastern Siberia, Kulunda Steppe, soda lake Tanatar-5
CountryRussian Federation
Medium88
Incubation temp. (C)30
Storage methodsC-1
DNA sequences16S rRNA gene: JF304642.1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40534
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40534 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 895 = Acht6-2, 2010
Source of isolationsediments of soda lake
GeographicsLibyan desert, Wadi el Natrun valley
CountryEgypt
Medium88
Incubation temp. (C)37
Storage methodsC-1
DNA sequences16S rRNA gene: JF304643
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40541
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40541 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 333 = ALMg5
Source of isolationsoda lake
GeographicsMongolia
CountryMongolia
Incubation temp. (C)30
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40554
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40554 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, RAS, Moscow, Russia, strain UNIQEM 926 = ABCh6
Source of isolationD.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia
GeographicsKulunda Steppe
CountryRussia
Incubation temp. (C)28
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 40961
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 40961<-- S.N.Filippova, UNIQEM 911 = K-3965, 2011 <-- V.D. Kuznetsov, a candidate for a new speies/genus
Locationunknown origin
Geographicsunknown origin
Countryunknown origin
Medium205
Incubation temp. (C)30
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 41933
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 41933 <--O.A. Podosokorskaya, Winogradsky Institute of Microbiology, FRC Biotechnology RAS, Russian Academy of Sciences, Moscow, Russia, strain OU-1-Tb, 2025
Source of isolationhotspring
GeographicsUrsdon, North Ossetia
CountryRussia
Incubation temp. (C)50
Storage methodsC-1
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Strain No.UNIQEM 42011
Scientific name of the strainGenus sp.
HistoryUNIQEM, UQM 42011 <-- À.I. Karaseva, Winogradsky Institute of Microbiology, FRC Biotechnology RAS, Russian Academy of Sciences, Moscow, Russia, strain AK-4214, 2025
Source of isolationhot spring, water and sediment sample
GeographicsUzon, Kamchatka
CountryRussia
Medium248
Incubation temp. (C)70
Storage methodsS-1
DNA sequences16S rRNA gene: TGCGAGTCATGGGGTCGCAAGACACCGGCGCACGGCTCAGTAACACGCGGATAATCTATCCTCTGGTGGGGGATAACCTCGGGAAACTGAGGCTAATACCCCATAGATATTCAATGCTGGAAGGCTTGGATATCGAAAGCGCAAGCGCCAGAGGGTGAGTCTGCGGCCTATCAGGTAGTAGGTGGTGTAACGGACCACCTAGCCTAAGACGGGTACGGGCCTTGAGAGAGGGAGCCCGGA
Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia)no

Updated 07/01/2026