Consolidated Catalogue
| Strain No. | UNIQEM 40062 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40062 < Bryantseva I.A. UNIQEM 258 |
| Location | Mono Lake |
| Geographics | Mono Lake |
| Country | USA |
| Medium | 261 |
| Incubation temp. (C) | 25 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40063 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40063 < Bryantseva I.A., UNIQEM 260 |
| Location | Mono Lake |
| Geographics | Mono Lake |
| Country | USA |
| Medium | 261 |
| Incubation temp. (C) | 25 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40064 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40064 < Bryantseva I.A., UNIQEM 257 |
| Location | Mono Lake |
| Geographics | Mono Lake |
| Country | USA |
| Medium | 261 |
| Incubation temp. (C) | 25 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40065 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40065 < Bryantseva I.A., UNIQEM 259 |
| Location | Mono Lake |
| Geographics | Mono Lake |
| Country | USA |
| Medium | 261 |
| Incubation temp. (C) | 25 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40066 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40066 < Bryantseva I.A. UNIQEM 261 |
| Location | Mono Lake |
| Geographics | Mono Lake |
| Country | USA |
| Medium | 261 |
| Incubation temp. (C) | 25 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40310 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40310 <-- D.Yu. Sorokin, Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain ASL6, 1999 |
| Source of isolation | sulfide-rich haloalkaline water |
| Geographics | Washington State, Grant County, Soap Lake |
| Country | USA |
| Medium | 443 |
| Incubation temp. (C) | 28 |
| Storage methods | C-1 |
| DNA sequences | 16S rRNA gene: DQ900621.1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40327 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40327 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 380 = ES1 |
| Source of isolation | soda solonchak soil |
| Geographics | Wadi Natrun |
| Country | Egypt |
| Incubation temp. (C) | 25 |
| Storage methods | C-1 |
| DNA sequences | 16S rRNA gene: EU143686 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40328 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40328 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 379= MS5 |
| Source of isolation | soda solonchak soil |
| Geographics | Mongolian north-eastern area |
| Country | Mongolia |
| Incubation temp. (C) | 25 |
| Storage methods | C-1 |
| DNA sequences | 16S rRNA gene: EU143684 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40332 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40332 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 933 = 93dLM4- |
| Source of isolation | soda lake |
| Geographics | Lake Magadi, Kenyan Rift Valley |
| Country | Kenya |
| Incubation temp. (C) | 37 |
| Storage methods | C-1 |
| DNA sequences | 16S rRNA gene: X92170 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40339 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40339 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 1004 = AMET-SL |
| Source of isolation | highly alkaline saline soda lake |
| Geographics | Searles Lake, California |
| Country | USA |
| Incubation temp. (C) | 50 |
| Storage methods | C-1 |
| DNA sequences | 16S rRNA gene: KY449327 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40410 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40410 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 922 = ACht9 |
| Source of isolation | soda solonchak soil near Tanatar-6 soda lake |
| Geographics | Kulunda Steppe |
| Country | Kulunda Steppe |
| Incubation temp. (C) | 30 |
| Storage methods | C-1 |
| DNA sequences | 16S rRNA gene: JQ901943 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40442 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40442 <-- D.Yu. Sorokin, Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 289 = AL 22 |
| Source of isolation | soda lake |
| Geographics | unknown origin |
| Medium | 336 |
| Incubation temp. (C) | 30 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40443 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40443 <-- D.Yu. Sorokin, Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 290 = 5B-1 |
| Source of isolation | soda lake |
| Geographics | Bitter-1 Lake, Kulunda steppe |
| Country | Russia |
| Medium | 336 |
| Incubation temp. (C) | 30 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40448 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40448 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 986 = AMET4 |
| Source of isolation | sediments from hypersaline soda lakes |
| Geographics | Kulunda Steppe, Altai |
| Country | Russian Federation |
| Incubation temp. (C) | 48 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40449 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40449 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 987 = AMET5 |
| Source of isolation | sediments from hypersaline soda lakes |
| Geographics | Kulunda Steppe, Altai |
| Country | Russian Federation |
| Incubation temp. (C) | 48 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40450 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40450 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 988 = AMET6-2 |
| Source of isolation | sediments from hypersaline soda lakes |
| Geographics | Wadi Natrun |
| Country | Egypt |
| Incubation temp. (C) | 60 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40453 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40453 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 985 = AMET3 |
| Source of isolation | sediments from hypersaline soda lakes |
| Geographics | Kulunda Steppe, Altai |
| Country | Russian Federation |
| Incubation temp. (C) | 48 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40455 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40455 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 984 = AMET2 |
| Source of isolation | sediments from hypersaline soda lakes |
| Geographics | Wadi Natrun |
| Country | Egypt |
| Incubation temp. (C) | 60 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40463 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40463 <-- D.Yu. Sorokin, UNIQEM 973; Aarcel, 2013 |
| Source of isolation | mixed sample hypersaline lake |
| Geographics | Libyan desert, Wadi el Natrun valley |
| Country | Egypt |
| Incubation temp. (C) | 37 |
| Storage methods | C-1 |
| DNA sequences | 16S rRNA gene: KT247982.1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40472 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40472 <-- D.Yu. Sorokin, UNIQEM 989; AMET7, 2012 |
| Source of isolation | soda crystallizer |
| Geographics | Kulunda Steppe |
| Country | Russian Federation |
| Incubation temp. (C) | 55 |
| Storage methods | C-1 |
| DNA sequences | 16S rRNA gene: KY449323.1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40478 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40478 <-- D.Yu. Sorokin, Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 357 = AL 31 |
| Source of isolation | soda lake |
| Geographics | unknown origin |
| Medium | 336 |
| Incubation temp. (C) | 30 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40479 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40479 <-- D.Yu. Sorokin, Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 356 = AL 30 |
| Source of isolation | soda lake |
| Geographics | unknown origin |
| Medium | 336 |
| Incubation temp. (C) | 30 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40480 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40480 <-- D.Yu. Sorokin, Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 355 = AL 29 |
| Source of isolation | soda lake |
| Geographics | unknown origin |
| Medium | 336 |
| Incubation temp. (C) | 30 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40481 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40481 <-- D.Yu. Sorokin, Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 354 = AL 28 |
| Source of isolation | soda lake |
| Geographics | unknown origin |
| Medium | 336 |
| Incubation temp. (C) | 30 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40483 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40483 <-- D.Yu. Sorokin, Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 352 = AL 26 |
| Source of isolation | soda lake |
| Geographics | unknown origin |
| Medium | 336 |
| Incubation temp. (C) | 30 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40484 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40484 <-- D.Yu. Sorokin, Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 351 = AL 25 |
| Source of isolation | soda lake |
| Geographics | unknown origin |
| Medium | 336 |
| Incubation temp. (C) | 30 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40485 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40485 <-- D.Yu. Sorokin, Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 350 = AL 24 |
| Source of isolation | soda lake |
| Geographics | unknown origin |
| Medium | 336 |
| Incubation temp. (C) | 30 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40486 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40486 <-- D.Yu. Sorokin, Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 349 = AL 23 |
| Source of isolation | soda lake |
| Geographics | unknown origin |
| Medium | 336 |
| Incubation temp. (C) | 30 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40495 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40495 <-- D.Yu. Sorokin, Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 340= ALMg10 |
| Source of isolation | soda lake |
| Geographics | Northeastern |
| Country | Mongolia |
| Incubation temp. (C) | 30 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40514 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40514 <-- D.Yu. Sorokin, UNIQEM 793; AHT16, 2009 |
| Source of isolation | surface sediments of soda lake |
| Geographics | Kulunda Steppe |
| Country | Russian Federation |
| Medium | 235 |
| Incubation temp. (C) | 30 |
| Storage methods | C-1 |
| DNA sequences | 16S rRNA gene: FJ788524 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40518 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40518 <-- D.Yu. Sorokin, UNIQEM 803; APP1, 2009 |
| Source of isolation | D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia |
| Geographics | Kulunda Steppe |
| Country | Russia |
| Incubation temp. (C) | 30 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40519 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40519 <-- D.Yu. Sorokin, UNIQEM 804; AP61, 2009 |
| Source of isolation | D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia |
| Geographics | Kulunda Steppe |
| Country | Russia |
| Incubation temp. (C) | 30 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40533 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40533 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 894 = Acht7, 2010 |
| Source of isolation | sediments of soda lake |
| Geographics | Altai, south-eastern Siberia, Kulunda Steppe, soda lake Tanatar-5 |
| Country | Russian Federation |
| Medium | 88 |
| Incubation temp. (C) | 30 |
| Storage methods | C-1 |
| DNA sequences | 16S rRNA gene: JF304642.1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40534 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40534 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 895 = Acht6-2, 2010 |
| Source of isolation | sediments of soda lake |
| Geographics | Libyan desert, Wadi el Natrun valley |
| Country | Egypt |
| Medium | 88 |
| Incubation temp. (C) | 37 |
| Storage methods | C-1 |
| DNA sequences | 16S rRNA gene: JF304643 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40541 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40541 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain UNIQEM 333 = ALMg5 |
| Source of isolation | soda lake |
| Geographics | Mongolia |
| Country | Mongolia |
| Incubation temp. (C) | 30 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40554 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40554 <-- D.Yu. Sorokin, Winogradsky Institute of Microbiology, RAS, Moscow, Russia, strain UNIQEM 926 = ABCh6 |
| Source of isolation | D.Yu. Sorokin, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia |
| Geographics | Kulunda Steppe |
| Country | Russia |
| Incubation temp. (C) | 28 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40961 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 40961<-- S.N.Filippova, UNIQEM 911 = K-3965, 2011 <-- V.D. Kuznetsov, a candidate for a new speies/genus |
| Location | unknown origin |
| Geographics | unknown origin |
| Country | unknown origin |
| Medium | 205 |
| Incubation temp. (C) | 30 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 41933 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 41933 <--O.A. Podosokorskaya, Winogradsky Institute of Microbiology, FRC Biotechnology RAS, Russian Academy of Sciences, Moscow, Russia, strain OU-1-Tb, 2025 |
| Source of isolation | hotspring |
| Geographics | Ursdon, North Ossetia |
| Country | Russia |
| Incubation temp. (C) | 50 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 42011 |
| Scientific name of the strain | Genus sp. |
| History | UNIQEM, UQM 42011 <-- À.I. Karaseva, Winogradsky Institute of Microbiology, FRC Biotechnology RAS, Russian Academy of Sciences, Moscow, Russia, strain AK-4214, 2025 |
| Source of isolation | hot spring, water and sediment sample |
| Geographics | Uzon, Kamchatka |
| Country | Russia |
| Medium | 248 |
| Incubation temp. (C) | 70 |
| Storage methods | S-1 |
| DNA sequences | 16S rRNA gene: TGCGAGTCATGGGGTCGCAAGACACCGGCGCACGGCTCAGTAACACGCGGATAATCTATCCTCTGGTGGGGGATAACCTCGGGAAACTGAGGCTAATACCCCATAGATATTCAATGCTGGAAGGCTTGGATATCGAAAGCGCAAGCGCCAGAGGGTGAGTCTGCGGCCTATCAGGTAGTAGGTGGTGTAACGGACCACCTAGCCTAAGACGGGTACGGGCCTTGAGAGAGGGAGCCCGGA |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |