Consolidated Catalogue
| Strain No. | UNIQEM 40147 |
| Scientific name of the strain | Halorubrum sp. |
| History | UNIQEM, UQM 40147 < Zvyagintseva I.S., UNIQEM 687; INMI 39 |
| Medium | 194 |
| Incubation temp. (C) | 37 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40153 |
| Scientific name of the strain | Halorubrum sp. |
| History | UNIQEM, UQM 40153 < Zvyagintseva I.S., UNIQEM 691; strain 502 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40154 |
| Scientific name of the strain | Halorubrum sp. |
| History | UNIQEM, UQM 40154 < Zvyagintseva I.S., UNIQEM 692; strain 44 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 40186 |
| Scientific name of the strain | Halorubrum sp. |
| History | UNIQEM, UQM 40186 <-- I.S. Zvyagintseva, UNIQEM 705, 2Z, 1999 <-- A. N. Nozhevnikova; Z-B12 |
| Source of isolation | salted soil |
| Geographics | unknown origin |
| Country | unknown origin |
| Medium | 194 |
| Incubation temp. (C) | 37 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 41893 |
| Scientific name of the strain | Halorubrum sp. |
| History | UNIQEM, UQM 41893 <- S.V. Kalenov, Mendeleyev University of Chemical Technology of Russia, Department of Biotechnology, strain SK-6, 2024 |
| Source of isolation | salt lake |
| Geographics | lake Alykes, Kos Island |
| Country | Greece |
| Medium | 44 |
| Incubation temp. (C) | 37 |
| Storage methods | C-1 |
| DNA sequences | 16S RNA gene: KY781161.1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 42013 |
| Scientific name of the strain | Halorubrum sp. |
| History | UNIQEM, UQM 42013 <- S.V. Kalenov, GEN PRO Ltd, strain SK-27, 2025 |
| Source of isolation | shallow water sediments and brine of the salt lake |
| Geographics | lake Masazir |
| Country | Azerbaijan |
| Medium | 44 |
| Incubation temp. (C) | 37 |
| Storage methods | C-1 |
| DNA sequences | 16S rRNA gene: TTCCGGTTGATCCTGCCGGAGGCCATTGCTATTGGGATCCGATTTAGCCATGCTAGTCGCACGAGTTCAGACTCGTGGCGAATAGCTCAGTAACACGTGGCCAAACTACCCTTCGGAGCACAATACCCTCGGGAAACTGAGGCTAATAGTGTATACCATACCACCACTGGAATGAGTGGTATGCCAAACGCTCCGGCGCCGAAGGATGTGGCTGCGGCCGATTAGGTAGACGGTGGGGTA |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |