Consolidated Catalogue
| Strain No. | VKM B-1257 |
| Scientific name of the strain | Thermus sp. |
| History | INMI, VKM B-1257 < Loginova L.G. INMI, 71 |
| Received as | Thermus flavus Saiki et al. 1972 |
| Source of isolation | thermal spring |
| Location | Kamchatka Peninsula |
| Geographics | Kamchatka Territory |
| Country | Russia |
| Medium | 142 |
| Incubation temp. (C) | 70 |
| Storage methods | F-1, S-5 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 41493 |
| Scientific name of the strain | Thermus sp. |
| History | UNIQEM, UQM 41493 <-- Kochetkova T.V., Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain 4228t |
| Source of isolation | hot spring |
| Geographics | Solnechny spring, Uzon caldera, Kamchatka |
| Country | RF |
| Incubation temp. (C) | 70 |
| Storage methods | C-1 |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 41821 |
| Scientific name of the strain | Thermus sp. |
| History | UNIQEM, UQM 41821 <-- A.I. Maltseva, Winogradsky Institute of Microbiology, Russian Academy of Sciences, Moscow, Russia, strain 4302-As, 2024 |
| Source of isolation | hot spring |
| Geographics | Uzon caldera, Kamchatka |
| Medium | 109 |
| Incubation temp. (C) | 60 |
| Growth condition | Cryo |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 41925 |
| Scientific name of the strain | Thermus sp. |
| History | UNIQEM, UQM 41925 <-- T.G.Sokolova, Winogradsky Institute of Microbiology, FRC Biotechnology RAS, Russian Academy of Sciences, Moscow, Russia, strain PS18, 2024 |
| Source of isolation | water and sediments mix sampled in hot spring |
| Geographics | lake Kipyashchee, Kunashir |
| Country | Russia |
| Medium | 248 |
| Incubation temp. (C) | 60 |
| Storage methods | C-1 |
| DNA sequences | genome: CP102606.1 19,473 bp circular DNA |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |
| Strain No. | UNIQEM 41927 |
| Scientific name of the strain | Thermus sp. |
| History | UNIQEM, UQM 41927 <-- T.G.Sokolova, Winogradsky Institute of Microbiology, FRC Biotechnology RAS, Russian Academy of Sciences, Moscow, Russia strain Uz 8, 2024 |
| Source of isolation | sediment of a thermal stream |
| Geographics | Navoi region |
| Country | Uzbekistan |
| Medium | 248 |
| Incubation temp. (C) | 65 |
| Storage methods | S-5 |
| DNA sequences | 16S rRNA: TCAGGGTGAACGCTGGCGGCGTGCCTAAGACGTGCAAGTCGTGCGAGGTGGTTCGCCACCC AGCGGCGGACGGGTGAGTAACGCGTGGGTGACCTGCCCGGAGGTGGAGGACAACCCGGGG AAACCCGGGCTAATCCCCCGTGTGGTCCCGGCCCATGGGCCGTGACTAAAGGCCGAAGGCCG CTTCCGGATGGGCCCGCGTCCCGTCAGCTAGTTGGTGGGGTAACGGCCCACCGAGGCAA |
| Pathogenicity group (SanPin 3.3686-21, 28.01.2021, Russia) | no |